Within this thread, I'm willing to concede each and every sundry point made by Creationists in an attempt to debunk evolution. In here at least, you win! Not only discrediting evolution, but even going as far as to establish Creationism as the only plausible theory. Congratulations!
So, what's next? Why, the next step for any scientific theory. Testing out the wazoo, predictions, studies, and efforts made to improve our understanding of the magnificent reality before us. And despite its... *ahem* notable age, Creationism "Theory" currently doesn't seem to have much of reality mapped out in a way that suits our very skeptical needs. No firmaments to be found, after all.
But what matters isn't how you got here, it's what you do now. What will Creationism bring to the table? In what manner can Creationism explain reality in a way that benefits humanity, especially in ways that evolution just wasn't able to? I want details. After all, to discard a scientific theory, you have to replace it with a theory of equal or greater merit, one with explanatory power to match or exceed the predecessor.
So, Creationists... Let's get started.
By Creationist logic, what kind of fossils should we expect to see in different rock layers?
By Creationist logic, what explains the precision of endogenous retroviral relics in our genome that maps to near perfect similarity to other species'?
By Creationist logic, what methods for interpreting radioactive decay can we use for the purpose of improving industry?
By Creationist logic, what is the best method for preventing and countering viral mutation and ensuring the general health is secured? Any pharmaceutical nuggets of wisdom you can enlighten us with?
By Creationist logic, what mechanism causes/prevents novel traits from appearing in species over successive generations?
By Creationist logic, what can you possibly offer to science to make up for supposedly destroying evolution? When evolutionary theory has not only made successful predictions, withstood 150 years of debate, and even intertwined with geology, paleontology, biology, chemistry, and physics in such a fitting way that it makes itself out to be the only logical explanation for the diversity of life as we see it?
Creationists, I'm tired of beating around the bush. For far too long, I've heard people make the claims that all the evidence backs Creationism. But if it has even an iota of evidence to it, if it has any explanatory power to make predictions about reality as we see it, in ways that evolutionary theory simply can't match, then show it.
Otherwise, quit trying to call Creationism a scientific theory.
Creationists, You (Hypothetically) Win!!!
Moderator: Moderators
- EarthScienceguy
- Guru
- Posts: 2324
- Joined: Thu Aug 16, 2018 2:53 pm
- Has thanked: 35 times
- Been thanked: 46 times
- Contact:
Post #111
[Replying to Donray]
Sure I can. Can you give me an observed example of duplication and mutation that caused a beneficial change in an organism.
Why are all men's Y chromosomes the same? Which points to a recent ancestor.
Why is a chimps Y chromosome only 70% like that of a man's Y Chromosome if they are related. That difference comparison is like between man and a chicken.
Neanderthals were modern men.
Men sin all the time and God does nothing to them. The Bible says that in the last days men will forget about the flood. All fossils were formed in a water environment covered with rock and soil so air could not get to them.
The fossil record has an abrupt layer of life that did not exist in the precambrian rock below.
The fossil record is a testament to the God who will one day judge the world. But that same judge is giving men time to make themselves right with Him.
EarthScienceguy belive in a Sky god that does things by magic and therefore needs to disprove evolution. He cannot logically debate his idea of how adaptation replaces evolution.
Sure I can. Can you give me an observed example of duplication and mutation that caused a beneficial change in an organism.
Why are all men's Y chromosomes the same? Which points to a recent ancestor.
Why is a chimps Y chromosome only 70% like that of a man's Y Chromosome if they are related. That difference comparison is like between man and a chicken.
There is no Naturalistic theory that can produce the material world in which we live. All naturalistic theory reality as an illusion. So your 99% of educated people believe in an illusion.Like a lot of Christians, he cannot have his faith challenged and will use lies and deception to make sure his beliefs are not destroyed. Unable to justify his beliefs he just tries to use Soto science to disprove what 99% of very educated people belive, that evolution is a fact.
Neanderthals could mate with modern men and did. Their brains were at least as large as modern men if not larger.The science guy has no explanation for other humans living in the past like Neanderthals. He says that any observable changes are due to heredity but cannot explin the difference between evolution and how his thinking that all the changes are due to heredity and adaptation are different from evolution.
Neanderthals were modern men.
Naturalistic theories predict that we are all make believe. I suppose if the theory is pushed far enough one could say that man can do anything if he believes he can even fly.Number one thing to remember when debating a religious person is that their sky god can do anything and therefore it is hard to say otherwise. Their god through its magic can do anything. Like superman it travels faster than the speed of light and lift the universe if needed. God is a judge and executioner, and no one can say its killings are murder because murder does apply to their god. This supernatural sky god cerates and controls all. This sky god even makes false fossils to confuse people.
Men sin all the time and God does nothing to them. The Bible says that in the last days men will forget about the flood. All fossils were formed in a water environment covered with rock and soil so air could not get to them.
The fossil record has an abrupt layer of life that did not exist in the precambrian rock below.
The fossil record is a testament to the God who will one day judge the world. But that same judge is giving men time to make themselves right with Him.
When atheists are clearly answered and they run away because they have lost, then they claim they were never answered, are they liars?
by AquinasForGod
by AquinasForGod
- Neatras
- Guru
- Posts: 1045
- Joined: Sat Dec 24, 2011 11:44 pm
- Location: Oklahoma, US
- Been thanked: 1 time
Post #112
Inventing an arsenal: adaptive evolution and neofunctionalization of snake venom phospholipase A2 genesEarthScienceguy wrote: [Replying to Donray]
EarthScienceguy belive in a Sky god that does things by magic and therefore needs to disprove evolution. He cannot logically debate his idea of how adaptation replaces evolution.
Sure I can. Can you give me an observed example of duplication and mutation that caused a beneficial change in an organism.
There, that was easy.These data show that increases in genomic complexity (through gene duplications) can lead to phenotypic complexity (venom composition) and that positive Darwinian selection is a common evolutionary force in snake venoms. Finally, regions identified under selection on the surface of phospholipase A2 enzymes are potential candidate sites for structure based antivenin design.
Because we're a monophyletic clade of sub-order hominids who routinely recombine and disseminate patrilineal DNA throughout the global population (in a process that preserves population cohesion for specific traits), a source of DNA that has almost no gene density and represents less than 1% of all the DNA in a male cell. If we were incapable of breeding geographically distinct human groups, we would find that the differences between them represented the emergence of a new evolved clade with a shared synapomorphy of standard hominid traits, plus divergent genes.Why are all men's Y chromosomes the same? Which points to a recent ancestor.
By the way, you don't get to make sweeping claims about "recent ancestor" for all men without providing some kind of evidence to your claim. Otherwise I dismiss it outright. Current scientific consensus (meaning all contributions to the standing body of knowledge) put Y-chromosomal Adam 200k-300k years ago. Appropriating the claims of science to prop up phony pseudoscientific claims isn't advised. If the current science does not say what you want it to say, that does not give you liberty to change their words. The world represents no physical evidence indicative of magical creation 7,000 years ago, which is standard creationist fare (I'll give you the benefit of the doubt and hope you're at least an Old Earth Creationist, they're more fun to talk to).
Chimps and humans have diverged, and as a result chimps no longer have an influence on the genetic drift of human Y-chromosomes, and vice versa. Under what circumstance would you expect us to maintain genetically volatile and population-driven chemical similarities to a group that we do not breed with? No evolutionary biologist would ever claim that the genetic similarity between two populations must remain the same even long after divergence.Why is a chimps Y chromosome only 70% like that of a man's Y Chromosome if they are related. That difference comparison is like between man and a chicken.
All posturing, no substance.There is no Naturalistic theory that can produce the material world in which we live. All naturalistic theory reality as an illusion. So your 99% of educated people believe in an illusion.Like a lot of Christians, he cannot have his faith challenged and will use lies and deception to make sure his beliefs are not destroyed. Unable to justify his beliefs he just tries to use Soto science to disprove what 99% of very educated people belive, that evolution is a fact.
Neanderthals were another species of human.Neanderthals could mate with modern men and did. Their brains were at least as large as modern men if not larger.The science guy has no explanation for other humans living in the past like Neanderthals. He says that any observable changes are due to heredity but cannot explin the difference between evolution and how his thinking that all the changes are due to heredity and adaptation are different from evolution.
Neanderthals were modern men.
All posturing, no substance. It's the religious who claim that "faith the size of a mustard seed could move mountains" and that your wish-granting god will give you anything as long as you ask (though, now that apologia has caught up to the overly promissory claims of that old religion, that has changed to "ask, but it's only granted if that's what the plan was to begin with, thereby rendering the request meaningless). Science gives us the tools to interact with the physical world in ways that benefit us; we don't depend on magical thinking like theists, we use what is available to us. We use planes to fly, not faith.Naturalistic theories predict that we are all make believe. I suppose if the theory is pushed far enough one could say that man can do anything if he believes he can even fly.Number one thing to remember when debating a religious person is that their sky god can do anything and therefore it is hard to say otherwise. Their god through its magic can do anything. Like superman it travels faster than the speed of light and lift the universe if needed. God is a judge and executioner, and no one can say its killings are murder because murder does apply to their god. This supernatural sky god cerates and controls all. This sky god even makes false fossils to confuse people.
All posturing, no substance. Be sure to try and bring up evidence sometime.Men sin all the time and God does nothing to them. The Bible says that in the last days men will forget about the flood. All fossils were formed in a water environment covered with rock and soil so air could not get to them.
Are you referring to the Cambrian Explosion, which had a high degree of biodiversity? That doesn't work for flood geology because an increase in biodiversity is at odds with the claims of special creation. Unless you'd like to propose hyper-fast evolution that builds new evolutionary clades in a matter of weeks, rendering your position so far in the extreme of "pseudoscience" as to render this conversation comical.The fossil record has an abrupt layer of life that did not exist in the precambrian rock below.
All posturing. No substance.The fossil record is a testament to the God who will one day judge the world. But that same judge is giving men time to make themselves right with Him.
- brunumb
- Savant
- Posts: 6048
- Joined: Thu Nov 02, 2017 4:20 am
- Location: Melbourne
- Has thanked: 6925 times
- Been thanked: 3244 times
Post #113
[Replying to post 110 by EarthScienceguy]
That surely qualifies as the lamest excuse proffered by Christians for the conspicuous absence of God in the world. Even 2000 years after his last great alleged intervention, nothing has changed. God is still just sitting on his hands, waiting. Or, could it really be that there is no God there?But that same judge is giving men time to make themselves right with Him.
George Orwell:: “The further a society drifts from the truth, the more it will hate those who speak it.”
Voltaire: "Those who can make you believe absurdities can make you commit atrocities."
Gender ideology is anti-science, anti truth.
Voltaire: "Those who can make you believe absurdities can make you commit atrocities."
Gender ideology is anti-science, anti truth.
-
Guy Threepwood
- Sage
- Posts: 502
- Joined: Wed Sep 28, 2016 6:00 pm
Post #114
[Replying to post 110 by EarthScienceguy]
But being left with only this alternative, is actually a pretty good test for anything that was intelligently created
Well- after every other theory was debunked, it's come down to some form of infinite probability generator- as the last remaining way to hypothetically create our world ... without any creative intelligence.There is no Naturalistic theory that can produce the material world in which we live. All naturalistic theory reality as an illusion. So your 99% of educated people believe in an illusion.
But being left with only this alternative, is actually a pretty good test for anything that was intelligently created
- EarthScienceguy
- Guru
- Posts: 2324
- Joined: Thu Aug 16, 2018 2:53 pm
- Has thanked: 35 times
- Been thanked: 46 times
- Contact:
Post #115
Wow this sure was impressive. I am sure that someone has observed this so called gene duplication and mutation. right.Inventing an arsenal: adaptive evolution and neofunctionalization of snake venom phospholipase A2 genes
Well, maybe not so much.
Your legless serpent article says this about their method of study.
That sure does sound like a lot of observational research there. Oh by gosh by gully.To study the molecular evolution of snake venom PLA2 genes, I compiled a dataset of 83 group-I and 90 group-II genes from public databases and inferred the evolutionary history of these genes using Bayesian phylogenetics [10]
And just in case you do not know what Bayesian Phylogenetic is and some of the problems.
From the abstract of the following article.
So your wonderful example of duplication and mutation is nothing but a fraud, a myth, a story, a big whopper. Made up by some computer programer who already believed that evolution happens.Bayesian methods have become very popular in molecular phylogenetics due to the availability of user-friendly software for running sophisticated models of evolution. However, Bayesian phylogenetic models are complex, and analyses are often carried out using default settings, which may not be appropriate. https://www.nature.com/articles/s41559-017-0280-x
This is no observation evidence. This little snake charmer story should be put where it belongs in the fiction sections, because that is what it is.
How about some real observational science now.
1917 there was a pandemic from the H1N1 virus, in 2009 the H1N1 virus went extinct because of the number of mutations in its genome.
The same article in the conclusion says the following.We document multiple extinction events, including the previously known extinction of the human H1N1 lineage in the 1950s, and an apparent second extinction of the human H1N1 lineage in 2009. These extinctions appear to be due to a continuous accumulation of mutations. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3507676/
Mutations do not help an organism they kill organisms. If the above is true then how could have anything survived millions of years.While there have been numerous adaptations within the H1N1 genome, most of the genetic changes we document here appear to be non-adaptive, and much of the change appears to be degenerative. We suggest H1N1 has been undergoing natural genetic attenuation, and that significant attenuation may even occur during a single pandemic. This process may play a role in natural pandemic cessation and has apparently contributed to the exponential decline in mortality rates over time, as seen in all major human influenza strains.
Evolution relies on mutations occurring and your snaky snake article says the following.Because we're a monophyletic clade of sub-order hominids who routinely recombine and disseminate patrilineal DNA throughout the global population (in a process that preserves population cohesion for specific traits), a source of DNA that has almost no gene density and represents less than 1% of all the DNA in a male cell. If we were incapable of breeding geographically distinct human groups, we would find that the differences between them represented the emergence of a new evolved clade with a shared synapomorphy of standard hominid traits, plus divergent genes.
This is because all observed duplication and then mutations are not beneficial to the organism. And as stated above these non beneficial mutations add up to cause the extinction of organism not the enhancement of organisms.Gene duplication followed by functional divergence has long been hypothesized to be the main source of molecular novelty. Convincing examples of neofunctionalization, however, remain rare.
If the man's Y chromosome has been around 200 - 300K then we should see major differences in the Y chromosomes because of mutations in the genome. And we should be able to identify these lines of mutations through the human populations. But that is not what we see. We do not see many mutations at all in the Y chromosome in fact all men have the same Y Chromosome. Where are all the mutations?By the way, you don't get to make sweeping claims about "recent ancestor" for all men without providing some kind of evidence to your claim. Otherwise I dismiss it outright. Current scientific consensus (meaning all contributions to the standing body of knowledge) put Y-chromosomal Adam 200k-300k years ago. Appropriating the claims of science to prop up phony pseudoscientific claims isn't advised. If the current science does not say what you want it to say, that does not give you liberty to change their words. The world represents no physical evidence indicative of magical creation 7,000 years ago, which is standard creationist fare (I'll give you the benefit of the doubt and hope you're at least an Old Earth Creationist, they're more fun to talk to).
Unless you are saying that there are no such thing as mutations in the genome but then you would have no consistency in evolutionary fairy tale.
Evolution is talking out of both sides of it hypothesis then.Chimps and humans have diverged, and as a result chimps no longer have an influence on the genetic drift of human Y-chromosomes, and vice versa. Under what circumstance would you expect us to maintain genetically volatile and population-driven chemical similarities to a group that we do not breed with? No evolutionary biologist would ever claim that the genetic similarity between two populations must remain the same even long after divergence.
Or did you forget that man and chimp is supposed to be 99% the same genetically. Except for the Y chromosome that is as far from a chimp as a human is from a chicken.
So evolution is trying to sell people on the story that in a couple of million years since man has evolved from chimps mutations in the Y chromosome has lead to a 70% difference. And yet in 200 to 300 k we have not seen a any shift in the Y chromosome.
Or as Shakespeare would say:
Quote:Evolutionist ability is top-drawer-rarely does anyone lie as convincingly or as artistically evolutionist do. Their skill has, in short, reached the zenith of perfection. Indeed, their mastery of the art is so great that their lying is almost always crowned with success-and they have no trouble seducing an unwary listener into believing that they are telling gospel truth
What theory would you be speaking of?There is no Naturalistic theory that can produce the material world in which we live. All naturalistic theory reality as an illusion. So your 99% of educated people believe in an illusion.
All posturing, no substance.
The problem is something called Boltzmann paradox.
The scientists were led by Svante Paabo of the Max Planck Institute for Evolutionary Anthropology, who was involved in the original sequencing of the Neanderthal genome (which we reported on last October). [Neanderthals] are not totally extinct, Paabo said. In some of us they live on, a little bit.Neanderthals were another species of human.
University of Wisconsin"Madison anthropologist John Hawks added, Theyre us. Were them. Hawks also noted that he was surprised at the extent of Neanderthal contributions to the modern human genome.
Really do not know what in the world you are trying to say. All creationist believe OBSERVATIONAL SCIENCE, which evolution is not.All posturing, no substance. It's the religious who claim that "faith the size of a mustard seed could move mountains" and that your wish-granting god will give you anything as long as you ask (though, now that apologia has caught up to the overly promissory claims of that old religion, that has changed to "ask, but it's only granted if that's what the plan was to begin with, thereby rendering the request meaningless). Science gives us the tools to interact with the physical world in ways that benefit us; we don't depend on magical thinking like theists, we use what is available to us. We use planes to fly, not faith.
Any "Scientific Theory" that is not rooted in OBSERVATIONAL SCIENCE is not not science but faith.
Are you trying to say that most fossils were not laid in a water environment?Quote:
Men sin all the time and God does nothing to them. The Bible says that in the last days men will forget about the flood. All fossils were formed in a water environment covered with rock and soil so air could not get to them.
All posturing, no substance. Be sure to try and bring up evidence sometime.
The evidence does not support that organisms change because of duplication and mutation. Except in some fantasy story that Darwin made up.Are you referring to the Cambrian Explosion, which had a high degree of biodiversity? That doesn't work for flood geology because an increase in biodiversity is at odds with the claims of special creation. Unless you'd like to propose hyper-fast evolution that builds new evolutionary clades in a matter of weeks, rendering your position so far in the extreme of "pseudoscience" as to render this conversation comical.
The evolutionary mechanism duplication and mutation has not evidenced the capability of producing this great of speciation in twenty million years. Along with second problem of build up of harmful mutations causing the extinction of organisms withing that time frame.
I do not believe in evolution I believe in special creation week one of creation week. This large extinction in fact all of the extinction that is observed in the fossil record can be attributed to one catastrophe not many.
I still stand by my statement
Quote:
The fossil record is a testament to the God who will one day judge the world. But that same judge is giving men time to make themselves right with Him.
When atheists are clearly answered and they run away because they have lost, then they claim they were never answered, are they liars?
by AquinasForGod
by AquinasForGod
- Neatras
- Guru
- Posts: 1045
- Joined: Sat Dec 24, 2011 11:44 pm
- Location: Oklahoma, US
- Been thanked: 1 time
Post #116
I'm proud of you, man. You changed the argument to suit your needs in a very agenda-driven way.
Here's how the structure of the argument from you was previously:
Evolution is impossible because duplication is always bad and always leads to extinction. Or something to that effect.
Then, when countered with evidence of duplication, you doubt the data collecting method, claiming that it wasn't observed and therefore doesn't count.
But here's where your verbal sleight of hand came into play:
The mechanism for adaptation due to duplication was explained and the data conforms to all observed evidence about biochemistry. And you don't want to accept that.
I'm going to make up two strings of DNA bases. Yes yes, whine about it if you need to, but it's to highlight a point:
Another case of you trying to get the scientific literature to say what you want it to say despite them saying otherwise.
Oh, and another thing.
This really is the structure of your argument:
1. An a priori declaration of "truth" that all observed duplication and then mutations are not beneficial to the organism.
2. A declaration that the only way for a duplication to be deemed beneficial is to watch the duplication event and then at the same time declare it to be beneficial.
3. Find a way around saying that the duplication event is beneficial by appealing to your first claim, that they are all by default deadly to the organism.
4. When we compare lineages (which if we actually spent the time, you would agree have shared origins) and discover that duplication events have occurred in the genome, you write it off because the duplication event wasn't observed and therefore it doesn't count, despite all the chemical mechanisms for driving these changes, and the computer simulations demonstrating how these changes affect the morphological and chemical structure of the organism are thrown out... because evolutionary theory is the mainstream of science. But but but, those methods are fine as long as they support your conclusion! (They don't, but your argument is inconsistent anyway, so it's fine.)

That Ken Ham talking point is as misleading as it is dangerous, but creationists desperately cling to it because they don't have what it takes to defend their points any other way. You have to pretend that reality is inconsistent when our backs are turned so we'll have no way of telling what happened when we try to make sense of the physical evidence in front of us.
Here's how the structure of the argument from you was previously:
Evolution is impossible because duplication is always bad and always leads to extinction. Or something to that effect.
Then, when countered with evidence of duplication, you doubt the data collecting method, claiming that it wasn't observed and therefore doesn't count.
But here's where your verbal sleight of hand came into play:
The mechanism for adaptation due to duplication was explained and the data conforms to all observed evidence about biochemistry. And you don't want to accept that.
I'm going to make up two strings of DNA bases. Yes yes, whine about it if you need to, but it's to highlight a point:
AATGTAGATTTAGATATTAAAGTATAATGA
These strings have very low similarity except around the edges. A lot of the internals are completely warped. However, I got the second string after just 5 more iterations. I only used mechanisms of mutation we already know about, namely addition, deletion, and substitution (I even left out recombination). You accept that all of these are possible. You just like to bluster and claim that it's "impossible" to get from one string to another.AATGTTAGATATAGGTATGGTATAATAATGA
I'm sorry you feel that way. Phylogenetics is a difficult field, and not everybody is cut out for it.EarthScienceguy wrote:Wow this sure was impressive. I am sure that someone has observed this so called gene duplication and mutation. right.Inventing an arsenal: adaptive evolution and neofunctionalization of snake venom phospholipase A2 genes
Well, maybe not so much.
Your legless serpent article says this about their method of study.
That sure does sound like a lot of observational research there. Oh by gosh by gully.To study the molecular evolution of snake venom PLA2 genes, I compiled a dataset of 83 group-I and 90 group-II genes from public databases and inferred the evolutionary history of these genes using Bayesian phylogenetics [10]
And just in case you do not know what Bayesian Phylogenetic is and some of the problems.
From the abstract of the following article.
So your wonderful example of duplication and mutation is nothing but a fraud, a myth, a story, a big whopper. Made up by some computer programer who already believed that evolution happens.Bayesian methods have become very popular in molecular phylogenetics due to the availability of user-friendly software for running sophisticated models of evolution. However, Bayesian phylogenetic models are complex, and analyses are often carried out using default settings, which may not be appropriate. https://www.nature.com/articles/s41559-017-0280-x
This is no observation evidence. This little snake charmer story should be put where it belongs in the fiction sections, because that is what it is.
I like your question. Because we are not viruses.EarthScienceguy wrote: How about some real observational science now.
1917 there was a pandemic from the H1N1 virus, in 2009 the H1N1 virus went extinct because of the number of mutations in its genome.
The same article in the conclusion says the following.We document multiple extinction events, including the previously known extinction of the human H1N1 lineage in the 1950s, and an apparent second extinction of the human H1N1 lineage in 2009. These extinctions appear to be due to a continuous accumulation of mutations. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3507676/
Mutations do not help an organism they kill organisms. If the above is true then how could have anything survived millions of years.While there have been numerous adaptations within the H1N1 genome, most of the genetic changes we document here appear to be non-adaptive, and much of the change appears to be degenerative. We suggest H1N1 has been undergoing natural genetic attenuation, and that significant attenuation may even occur during a single pandemic. This process may play a role in natural pandemic cessation and has apparently contributed to the exponential decline in mortality rates over time, as seen in all major human influenza strains.
The literature suggests RNA viruses should be inherently subject to mutational degeneration [9-13]. This includes the bacteriophage MS2 [14], the tobacco etch virus [15], HIV [16-19], dengue virus type-2 [20], Ebola [21,22], and SARS [23,24]. Some have suggested that intentionally increasing the rate of mutation accumulation (lethal mutagenesis) may be a way to control viral epidemics by hastening strain extinction [25-30]. There is some long-term historical evidence that supports the concept of natural viral attenuation through mutation accumulation [2], and theoretical studies using numerical simulation strongly support the concept of natural and accelerated genetic attenuation of RNA viruses [13].
Another case of you trying to get the scientific literature to say what you want it to say despite them saying otherwise.
Oh, and another thing.
So don't whine about phylogenetic studies when the article you cited relies on the exact same methods.Previous genetic studies examining the history of the influenza virus have performed extensive phylogenetic analyses of influenza genomes [8,31-35]. They have shown considerable nucleotide diversity among circulating strains, given clear evidence for adaptive selection of antigenic variants [36-42], and have shown that most of the major innovations within the flu genome have occurred via reassortment [5], by which one flu strain has recombined with another strain and obtained a segment of RNA from the second strain.
I see how it is.EarthScienceguy wrote:Evolution relies on mutations occurring and your snaky snake article says the following.Because we're a monophyletic clade of sub-order hominids who routinely recombine and disseminate patrilineal DNA throughout the global population (in a process that preserves population cohesion for specific traits), a source of DNA that has almost no gene density and represents less than 1% of all the DNA in a male cell. If we were incapable of breeding geographically distinct human groups, we would find that the differences between them represented the emergence of a new evolved clade with a shared synapomorphy of standard hominid traits, plus divergent genes.
This is because all observed duplication and then mutations are not beneficial to the organism. And as stated above these non beneficial mutations add up to cause the extinction of organism not the enhancement of organisms.Gene duplication followed by functional divergence has long been hypothesized to be the main source of molecular novelty. Convincing examples of neofunctionalization, however, remain rare.
This really is the structure of your argument:
1. An a priori declaration of "truth" that all observed duplication and then mutations are not beneficial to the organism.
2. A declaration that the only way for a duplication to be deemed beneficial is to watch the duplication event and then at the same time declare it to be beneficial.
3. Find a way around saying that the duplication event is beneficial by appealing to your first claim, that they are all by default deadly to the organism.
4. When we compare lineages (which if we actually spent the time, you would agree have shared origins) and discover that duplication events have occurred in the genome, you write it off because the duplication event wasn't observed and therefore it doesn't count, despite all the chemical mechanisms for driving these changes, and the computer simulations demonstrating how these changes affect the morphological and chemical structure of the organism are thrown out... because evolutionary theory is the mainstream of science. But but but, those methods are fine as long as they support your conclusion! (They don't, but your argument is inconsistent anyway, so it's fine.)
Not if patrilineal DNA regularly recombines throughout the entire population. Have you never even heard of population genetics? And again, the Y-chromosome accounts for 1% of all DNA in a male cell, and humans experience a mutation rate of about 100 mutations per individual. Populations can maintain homogeneity for long periods of time, while still experiencing regular divergence from their ancestral population in what is known as genetic drift.EarthScienceguy wrote:If the man's Y chromosome has been around 200 - 300K then we should see major differences in the Y chromosomes because of mutations in the genome.By the way, you don't get to make sweeping claims about "recent ancestor" for all men without providing some kind of evidence to your claim. Otherwise I dismiss it outright. Current scientific consensus (meaning all contributions to the standing body of knowledge) put Y-chromosomal Adam 200k-300k years ago. Appropriating the claims of science to prop up phony pseudoscientific claims isn't advised. If the current science does not say what you want it to say, that does not give you liberty to change their words. The world represents no physical evidence indicative of magical creation 7,000 years ago, which is standard creationist fare (I'll give you the benefit of the doubt and hope you're at least an Old Earth Creationist, they're more fun to talk to).
That's a claim, however you have nothing to back it up with. We do not find that "all men have the same Y Chromosome" because we can still identify groups and individuals entirely by the changes to the Y Chromosome. I don't know who sold you the idea that the Y Chromosome is a completely immortal DNA molecule that has never once been touched by time or chemistry, but they were lying to you.EarthScienceguy wrote: And we should be able to identify these lines of mutations through the human populations. But that is not what we see. We do not see many mutations at all in the Y chromosome in fact all men have the same Y Chromosome. Where are all the mutations?
Y chromosome homogeneity in the Korean population.
The distribution of Y-chromosomal variation from the 12 Y-SNP and 17 Y-STR markers was determined in six major provinces (Seoul-Gyeonggi, Gangwon, Chungcheong, Jeolla, Gyeongsang, and Jeju) to evaluate these populations' possible genetic structure and differentiation in Korea. As part of the present study, a 10-plex SNaPshot assay and two singleplex SNaPshot assays were developed. Based on the result of 12 Y-SNP markers (M9, M45, M89, M119, M122, M174, M175, M214, RPS4Y, P31, SRY465, and 47z), almost 78.9% of tested samples belonged to haplogroup O-M175 (including its subhaplogroups O3-M122: 44.3%, O2b*-SRY465: 22.5%, O2b1-47z: 8.7%), and 12.6% of the tested samples belonged to haplogroup C-RPS4Y. A total of 475 haplotypes were identified using 17 Y-STR markers included in the Yfiler kit, among which 452 (95.2%) were individual-specific. The overall haplotype diversity for the 17 Y-STR loci was 0.9997 and the discrimination capacity was 0.9387. Pairwise genetic distances and AMOVA of the studied Korean provinces reflected no patrilineal substructure in Korea, except for Jeju Island. Thus, this survey shows that the present data of Korean individuals could be helpful to establish a comprehensive forensic reference database for frequency estimation.
Yeah I'm just gonna leave this here as a clear obfuscation of my position.EarthScienceguy wrote: Unless you are saying that there are no such thing as mutations in the genome but then you would have no consistency in evolutionary fairy tale.
No, actually. Genetic drift has never once been challenged by the likes of you.EarthScienceguy wrote:Evolution is talking out of both sides of it hypothesis then.Chimps and humans have diverged, and as a result chimps no longer have an influence on the genetic drift of human Y-chromosomes, and vice versa. Under what circumstance would you expect us to maintain genetically volatile and population-driven chemical similarities to a group that we do not breed with? No evolutionary biologist would ever claim that the genetic similarity between two populations must remain the same even long after divergence.
The 99% similarity is after we trim out the evident gene duplication and deletion events in our genomes because they affect the base-to-base comparison. If you're torn up over that, rest assured, we're more like 85% identical. But every single base pair, gene, and genomic difference can be traced back using known mutation mechanisms. So the creationist myth that it's "impossible" to go from one lineage to another is nothing but hot air. It turns out that when a single lineage separates into multiple lineages, the two lineages end up with differences. Shocker, huh?EarthScienceguy wrote: Or did you forget that man and chimp is supposed to be 99% the same genetically. Except for the Y chromosome that is as far from a chimp as a human is from a chicken.
We're seeing Y-chromosomal mutations happen right now. Somebody really pulled the wool over your eyes if you're willing to parrot their falsehood so easily.EarthScienceguy wrote: So evolution is trying to sell people on the story that in a couple of million years since man has evolved from chimps mutations in the Y chromosome has lead to a 70% difference. And yet in 200 to 300 k we have not seen a any shift in the Y chromosome.
Shakespeare, the leading biologist of his time.EarthScienceguy wrote: Or as Shakespeare would say:
Evolutionist ability is top-drawer-rarely does anyone lie as convincingly or as artistically evolutionist do. Their skill has, in short, reached the zenith of perfection. Indeed, their mastery of the art is so great that their lying is almost always crowned with success-and they have no trouble seducing an unwary listener into believing that they are telling gospel truth
Neanderthal DNA in somebody does not make them a Neanderthal. Unless you'd like to argue that all Europeans are Neanderthals, which would be really poorly advised.EarthScienceguy wrote: Quote:
What theory would you be speaking of?There is no Naturalistic theory that can produce the material world in which we live. All naturalistic theory reality as an illusion. So your 99% of educated people believe in an illusion.
All posturing, no substance.
The problem is something called Boltzmann paradox.
The scientists were led by Svante Paabo of the Max Planck Institute for Evolutionary Anthropology, who was involved in the original sequencing of the Neanderthal genome (which we reported on last October). [Neanderthals] are not totally extinct, Paabo said. In some of us they live on, a little bit.Neanderthals were another species of human.
University of Wisconsin"Madison anthropologist John Hawks added, Theyre us. Were them. Hawks also noted that he was surprised at the extent of Neanderthal contributions to the modern human genome.
Yep, go on, remove the portion that I quoted which gives context. I don't care.EarthScienceguy wrote:Really do not know what in the world you are trying to say. All creationist believe OBSERVATIONAL SCIENCE, which evolution is not.All posturing, no substance. It's the religious who claim that "faith the size of a mustard seed could move mountains" and that your wish-granting god will give you anything as long as you ask (though, now that apologia has caught up to the overly promissory claims of that old religion, that has changed to "ask, but it's only granted if that's what the plan was to begin with, thereby rendering the request meaningless). Science gives us the tools to interact with the physical world in ways that benefit us; we don't depend on magical thinking like theists, we use what is available to us. We use planes to fly, not faith.
Yep, all forensic science is just taken on faith! Wait...EarthScienceguy wrote: Any "Scientific Theory" that is not rooted in OBSERVATIONAL SCIENCE is not not science but faith.
That Ken Ham talking point is as misleading as it is dangerous, but creationists desperately cling to it because they don't have what it takes to defend their points any other way. You have to pretend that reality is inconsistent when our backs are turned so we'll have no way of telling what happened when we try to make sense of the physical evidence in front of us.
The global flood is a myth, sorry to break it to you.EarthScienceguy wrote:Are you trying to say that most fossils were not laid in a water environment?Quote:
Men sin all the time and God does nothing to them. The Bible says that in the last days men will forget about the flood. All fossils were formed in a water environment covered with rock and soil so air could not get to them.
All posturing, no substance. Be sure to try and bring up evidence sometime.
Darwin didn't have a single clue what genetics or DNA were. So your misattribution of his beliefs is noted. Do you actually have any awareness about the field of science you are trying to mock?EarthScienceguy wrote:The evidence does not support that organisms change because of duplication and mutation. Except in some fantasy story that Darwin made up.Are you referring to the Cambrian Explosion, which had a high degree of biodiversity? That doesn't work for flood geology because an increase in biodiversity is at odds with the claims of special creation. Unless you'd like to propose hyper-fast evolution that builds new evolutionary clades in a matter of weeks, rendering your position so far in the extreme of "pseudoscience" as to render this conversation comical.
Genetic Entropy was debunked a thousand times over, and will be a thousand times more. You're merely parroting more wrong-headed anti-intellectuals and hoping mere assertion will be enough to convince anyone.EarthScienceguy wrote: The evolutionary mechanism duplication and mutation has not evidenced the capability of producing this great of speciation in twenty million years. Along with second problem of build up of harmful mutations causing the extinction of organisms withing that time frame.
More myths, eh? Well, take one, I guess you take 'em all. So when you rear cattle, do you make them look at striped sticks while mating to get striped offspring?EarthScienceguy wrote: I do not believe in evolution I believe in special creation week one of creation week. This large extinction in fact all of the extinction that is observed in the fossil record can be attributed to one catastrophe not many.
All posturing, no substance.EarthScienceguy wrote: I still stand by my statement
Quote:
The fossil record is a testament to the God who will one day judge the world. But that same judge is giving men time to make themselves right with Him.
- rikuoamero
- Under Probation
- Posts: 6707
- Joined: Tue Jul 28, 2015 2:06 pm
- Been thanked: 4 times
Post #117
[Replying to post 114 by EarthScienceguy]
Just to remind you, I'm still awaiting an answer in the Ask a User subsection of the forum, as to how creationists such as yourself are actually scientists honestly practising the scientific method, when you and yours have websites that demand of their members that they do not question certain dogmas.
Just to remind you, I'm still awaiting an answer in the Ask a User subsection of the forum, as to how creationists such as yourself are actually scientists honestly practising the scientific method, when you and yours have websites that demand of their members that they do not question certain dogmas.

Your life is your own. Rise up and live it - Richard Rahl, Sword of Truth Book 6 "Faith of the Fallen"
I condemn all gods who dare demand my fealty, who won't look me in the face so's I know who it is I gotta fealty to. -- JoeyKnotHead
Some force seems to restrict me from buying into the apparent nonsense that others find so easy to buy into. Having no religious or supernatural beliefs of my own, I just call that force reason. -- Tired of the Nonsense
- EarthScienceguy
- Guru
- Posts: 2324
- Joined: Thu Aug 16, 2018 2:53 pm
- Has thanked: 35 times
- Been thanked: 46 times
- Contact:
Post #118
[Replying to Neatras]
Ok, let's get real narrow then.
I am even willing to go out on a limb and say "there has never been a duplication and mutation that has been beneficial to the organism."
Then you gave some bogus snake article that I refuted and rejected, by demonstrating how it was not observational science that Lynchy was doing.
And you try to counter that with this
So why should anyone believe evolution when its main driver duplication and mutation cannot be observed in any beneficial way? A person who believes evolution is true has way more faith than I have.
Like this quote that you so graciously gave me.
Quote:
If you would have kept reading you would have read this paragraph.
Extrapolating this OBSERVED DATA makes it very unlikely for an organism to undergo millions of years of genetic mutation build up and survive.
So do you have ANY OBSERVED duplication and mutations that even benefitted an organism?
Ok, let's get real narrow then.
This is not quite what I said, I said. What I expressed was evolution is impossible because there has never been observed a duplication and mutation that has not added to the mutation build up that causes an organism to go extinct.Evolution is impossible because duplication is always bad and always leads to extinction. Or something to that effect.
I am even willing to go out on a limb and say "there has never been a duplication and mutation that has been beneficial to the organism."
Then you gave some bogus snake article that I refuted and rejected, by demonstrating how it was not observational science that Lynchy was doing.
And you try to counter that with this
In SCIENCE it is not believed and should not be believed until it is observed and repeated. Evolutionary "scientist" are the only ones that seem to want to break that principle. I do not believe in negative space even though it can be calculated in mathematics. Einstein's theory of gravity was not truly accepted until gravity probe B demonstrated right after the turn of this century.Then, when countered with evidence of duplication, you doubt the data collecting method, claiming that it wasn't observed and therefore doesn't count.
But here's where your verbal sleight of hand came into play:
The mechanism for adaptation due to duplication was explained and the data conforms to all observed evidence about biochemistry. And you don't want to accept that.
So why should anyone believe evolution when its main driver duplication and mutation cannot be observed in any beneficial way? A person who believes evolution is true has way more faith than I have.
Like this quote that you so graciously gave me.
Quote:
So Lynchy's snaky article even has more problems. PREVIOUS phylogenetic analyses showed something different than what was OBSERVED.Previous genetic studies examining the history of the influenza virus have performed extensive phylogenetic analyses of influenza genomes [8,31-35]. They have shown considerable nucleotide diversity among circulating strains, given clear evidence for adaptive selection of antigenic variants [36-42], and have shown that most of the major innovations within the flu genome have occurred via reassortment [5], by which one flu strain has recombined with another strain and obtained a segment of RNA from the second strain.
If you would have kept reading you would have read this paragraph.
It are these changes in the larger portion of the genome that cause extinction caused the extinction in H1N1.While phylogenetic studies can build robust family trees, they do so by focusing only on a limited number of informative genomic locations [44]. Even though the influenza genome is broken into eight separate RNAs, unless an individual is infected with two strains simultaneously (providing an opportunity for reassortment), all eight sections are inherited as a set in a form of linkage [36]. Thus, neutral and slightly deleterious mutations are carried along with those mutations under positive or purifying selection. This gives us enough information to make many phylogenetic inferences, and we have a wealth of data telling us the history of the various viral lines, but these phylogenetic techniques ignore genetic change within a larger portion of the genome in order to focus on the phylogenetically-informative sites.
Extrapolating this OBSERVED DATA makes it very unlikely for an organism to undergo millions of years of genetic mutation build up and survive.
So do you have ANY OBSERVED duplication and mutations that even benefitted an organism?
When atheists are clearly answered and they run away because they have lost, then they claim they were never answered, are they liars?
by AquinasForGod
by AquinasForGod
- Neatras
- Guru
- Posts: 1045
- Joined: Sat Dec 24, 2011 11:44 pm
- Location: Oklahoma, US
- Been thanked: 1 time
Post #119
[Replying to post 117 by EarthScienceguy]
I like how you completely side-stepped my calling out your Ken Ham talking point about how we can "only" submit events we physically observe into science.
Rational people will reject this because forensic science is still a thing.
If we were to apply your standard, (not only would we reject the Bible outright, but) there would be no space program, no forensic science, no biological science, no geology, etc. Which could possibly be what you want.
I am curious about your science background, because you woefully misrepresent the scientific method with every post I've observed so far.
I'm going to offer you this little nugget of an idea:
Chemistry is a verifiable. Genetics falls under chemistry. So we don't have to individually watch every chemical reaction to be able to understand what happens. Direct observation informs us about processes, and once we understand a process we apply that knowledge because we know reality is consistent. Your rejection of this idea (which can only be a rejection because for all the world I've never seen creationists embrace this idea, they have to reject it in order to prop up Ken Ham's fallacious arguments) has no place in science. So it turns out the person warping science to their own goals... was you.
I like how you completely side-stepped my calling out your Ken Ham talking point about how we can "only" submit events we physically observe into science.
Rational people will reject this because forensic science is still a thing.
If we were to apply your standard, (not only would we reject the Bible outright, but) there would be no space program, no forensic science, no biological science, no geology, etc. Which could possibly be what you want.
I am curious about your science background, because you woefully misrepresent the scientific method with every post I've observed so far.
I'm going to offer you this little nugget of an idea:
Chemistry is a verifiable. Genetics falls under chemistry. So we don't have to individually watch every chemical reaction to be able to understand what happens. Direct observation informs us about processes, and once we understand a process we apply that knowledge because we know reality is consistent. Your rejection of this idea (which can only be a rejection because for all the world I've never seen creationists embrace this idea, they have to reject it in order to prop up Ken Ham's fallacious arguments) has no place in science. So it turns out the person warping science to their own goals... was you.
- EarthScienceguy
- Guru
- Posts: 2324
- Joined: Thu Aug 16, 2018 2:53 pm
- Has thanked: 35 times
- Been thanked: 46 times
- Contact:
Post #120
[Replying to post 118 by Neatras]
For example
In the 1980's a team of scientist believed they had found evidence of nuclear fusion occurring during the electrolysis of water. But because no other team of scientist could reproduce there experiment so the physics community discredited this team of scientist.
Forensic science can have a idea of what happen but it does not test its hypothesis as the hard sciences do.
The scientific method in any science book is as follows.
1. Observe an unexplained phenomenon.
2. Ask a testable question
3. Form a testable question
4. Form an experiment
5. Analyze results.
6. Form a conclusion
7. Communicate results
Here is a little song that will help you learn the scientific method.
Notice the number observations and then step 7 would be duplication.
This is not the case with evolution. Evolution would not have predicted the extinction of the H1N1 virus. It would have predicted that this virus would have become more and more deadly to humans as it evolved.
For example:
In the 1990's physicist believed that the universe was slowing down. And then in the late 1990's the expansion of the universe was measured and what was OBSERVED rocked the physics community. They discovered that the universe was not decelerating but accelerating. From this they could also measure the OBSERVED value of dark energy and they discovered that they were off by an order of 120.
Nothing is considered true in science unless it can be directly observed.
I'm going to offer you this little nugget of an idea:
I understand your desire to change the scientific method when there is no observational evidence to support your belief system.
But I deal in observable evidence. And observation reveals that evolution
1. Has no observable mechanism (there is no observational evidence that duplication and mutation cause any benefit to an organism.
2. Observational evidence indicates that time is detrimental to an organism because of mutations not beneficial.
3. Evolutions failed predictions
In 1963, Harvards leading evolutionary theorist Ernst Mayr predicted that looking for similar DNA between very diverse organisms would be pointless. He claimed that random genetic changes over millions of years explained the differences in creatures traits and that those many changes would have obliterated genetic similarities.
This has been proven to be utterly incorrect with the discovery of the hox genes. This was not fridge thought but one of the major teachings of evolutions.
There was also Darwin's theory of gradual change. One of the main tenets of evolution was discarded replaced by punctuated equilibrium.
Creationist predicted that junk DNA does have a function in the genome and that was confirmed.
And before you start telling me about all of the successful predictions of evolution make sure that these predictions are the result of duplication and mutation the main driving force of evolutionary change. Because every other type of change would be caused by heredity and creationist would predict the same change.
Forensic science cannot reproduce any event that they are investigating. This is evidenced by the number of inmates that released by new evidence. Reproduction is a vital element in the hard sciences.I like how you completely side-stepped my calling out your Ken Ham talking point about how we can "only" submit events we physically observe into science.
Rational people will reject this because forensic science is still a thing.
For example
In the 1980's a team of scientist believed they had found evidence of nuclear fusion occurring during the electrolysis of water. But because no other team of scientist could reproduce there experiment so the physics community discredited this team of scientist.
Forensic science can have a idea of what happen but it does not test its hypothesis as the hard sciences do.
Really, why is that.If we were to apply your standard, (not only would we reject the Bible outright, but) there would be no space program, no forensic science, no biological science, no geology, etc. Which could possibly be what you want.
The scientific method in any science book is as follows.
1. Observe an unexplained phenomenon.
2. Ask a testable question
3. Form a testable question
4. Form an experiment
5. Analyze results.
6. Form a conclusion
7. Communicate results
Here is a little song that will help you learn the scientific method.
Notice the number observations and then step 7 would be duplication.
A chemical reaction is repeatable. We can even predict what will happen when two chemicals are reacted.Chemistry is a verifiable. Genetics falls under chemistry. So we don't have to individually watch every chemical reaction to be able to understand what happens.
This is not the case with evolution. Evolution would not have predicted the extinction of the H1N1 virus. It would have predicted that this virus would have become more and more deadly to humans as it evolved.
Direct observations have on many, many occasions have totally rewritten science textbooks.Direct observation informs us about processes, and once we understand a process we apply that knowledge because we know reality is consistent.
For example:
In the 1990's physicist believed that the universe was slowing down. And then in the late 1990's the expansion of the universe was measured and what was OBSERVED rocked the physics community. They discovered that the universe was not decelerating but accelerating. From this they could also measure the OBSERVED value of dark energy and they discovered that they were off by an order of 120.
Nothing is considered true in science unless it can be directly observed.
YOUR view of the scientific method is only used in evolution because of the lack of observational evidence.Your rejection of this idea (which can only be a rejection because for all the world I've never seen creationists embrace this idea, they have to reject it in order to prop up Ken Ham's fallacious arguments) has no place in science. So it turns out the person warping science to their own goals... was you.
What do you believe the scientific method is?I am curious about your science background, because you woefully misrepresent the scientific method with every post I've observed so far.
I'm going to offer you this little nugget of an idea:
I have no problem with this in fact the these reaction have to flows Gibbs law. Look at "Evolution RIP".Chemistry is a verifiable. Genetics falls under chemistry. So we don't have to individually watch every chemical reaction to be able to understand what happens.
Direct observation does inform us on perceived processes and it are these perceived processes that lead to prediction. But these predictions need to be verified by observation.Direct observation informs us about processes, and once we understand a process we apply that knowledge because we know reality is consistent.
Which textbook did you quote your view of the scientific method from? People write songs about the scientific method that I listed above. And pretty much every science textbook in print will have the same steps in the scientific method as I listed above.Your rejection of this idea (which can only be a rejection because for all the world I've never seen creationists embrace this idea,
I understand your desire to change the scientific method when there is no observational evidence to support your belief system.
But I deal in observable evidence. And observation reveals that evolution
1. Has no observable mechanism (there is no observational evidence that duplication and mutation cause any benefit to an organism.
2. Observational evidence indicates that time is detrimental to an organism because of mutations not beneficial.
3. Evolutions failed predictions
In 1963, Harvards leading evolutionary theorist Ernst Mayr predicted that looking for similar DNA between very diverse organisms would be pointless. He claimed that random genetic changes over millions of years explained the differences in creatures traits and that those many changes would have obliterated genetic similarities.
This has been proven to be utterly incorrect with the discovery of the hox genes. This was not fridge thought but one of the major teachings of evolutions.
There was also Darwin's theory of gradual change. One of the main tenets of evolution was discarded replaced by punctuated equilibrium.
Creationist predicted that junk DNA does have a function in the genome and that was confirmed.
And before you start telling me about all of the successful predictions of evolution make sure that these predictions are the result of duplication and mutation the main driving force of evolutionary change. Because every other type of change would be caused by heredity and creationist would predict the same change.
When atheists are clearly answered and they run away because they have lost, then they claim they were never answered, are they liars?
by AquinasForGod
by AquinasForGod

